7 500 000 - 9 500 000 CNY (1 073 237 - 1 359 434 US$) Vendu pour ... 410. Artiste. Zeng Fanzhi. Titre. Road. Média. oil on canvas. Taille. 86,6 x 157,5 in. ...
http://www.artnet.fr/pdb/publicauctionresults.aspx?collection_id=138357

5. Ugly Betty (r) : 7.410.000. 6. The Office (21h00) (r) : 5.770.000 ... 3. ABC : Ugly Betty (r) : 7.410.000. 4. NBC : The Office (r) : 4.910.000 ...
http://series-chiffres.blogs.allocine.fr/index.blog?blog=series-chiffres&month=3&year=2007

25 000 - 35 000 BP (43 410 - 60 774 US$) Vendu pour. 27 500 BP (44 949 US$) PREMIUM ... 8 000 BP (10 418 - 13 891 US$) Vendu pour. BOUGHT IN. 1 2 3 4 5 6 7 8 9 ...
http://www.artnet.fr/pdb/PublicAuctionResults.aspx?collection_id=147658

Les arrivées et rapports pour le Prix de l'Ile d'Oléron du jeudi 6 novembre ... 5 6 7 8 9 ... 6 ans ayant gagné au moins 80.000. - Recul de 25 m. à 410.000. ...
http://www.geny.com/ArriveesEtRapportsPMU/c/208863/2008-11-06-Vincennes-Prix-de-l-Ile-d-Oleron.htm?xtor=RSS-1

49 € - 280. € 280 € - 410. € 410 € - 650. € 650 € - 1 200. € 1 200 € - 3 000. € 3 000 € - 11 600 ... Page 1 2 3 4 5 6 7 8 9 10 sur 204. Suivant. Afficher: ...
http://shopping.msn.fr/results/gros-%C3%A9lectrom%C3%A9nager/bcatid74/e-distri.com/12-24582/forsale?text=category:gros-%C3%A9lectrom%C3%A9nager+Marchand:e-distri.com

4. New York Section Criminelle (s06e17) : 8.850.000 (- 5. Shark (s01e07) (r) : 7.590.000 ... 4. CBS : The Unit, Commando D'Élite (r) : 7.340.000 ...
http://series-chiffres.blogs.allocine.fr/series-chiffres-90769-mardi_2703__dancing_with_the_stars_affaiblit_le_dr_house.htm

110 € - 210. € 210 € - 310. € 310 € - 410. € 410 € - 590. € 590 € - 660 ... Page 4 5 6 7 8 9 10 11 12 13 sur 334. Suivant. Afficher: Liste Grille Texte. Aide ...
http://shopping.msn.fr/results/mobiles-avec-forfait/bcatid3785/forsale?text=category:mobiles-avec-forfait&page=8

ChloroP V1.1 Prediction Results # Number of query sequences: 1 # Neural network ... 005 0.001 -7.833 302 K 0.004 0.001 -11.033 303 I 0.004 0.000 ...
http://www.inra.fr/internet/Produits/TAARSAT/AlaRS/SYAP_ARATH_ChloroP.txt

... 1190 1200 1210 1220 400 410 420 430 440 MuCns- AAACCACCAACTCGAGAACTTGTGGGGAA ... 0 Smith-Waterman score: 76; 75.000% identity in 32 nt overlap Entrez lookup ...
http://tagc.univ-mrs.fr/pub/vanin/MuCns-HuCns/7-r.html

LORD OF MEN. TAKE THE LIGHT. Taillis. Sold. MONTZEY Bru. 7 000 ... 30 000. € 410. F. PEARL QUEEN. ENRIQUE. ASHKADIMA. Logis Saint G. Sold. MAB AGENCY. 13 000 ...
http://www.arqana.com/thoroughbred/index.php?pageid=3&venid=110&afCatalogue_page=1&afCatalogue_order=lot_code&lot_jourv_filter=Mer